tol2 transposase rna (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
tol2 transposase rna
Tol2 Transposase Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tol2+transposase+rna/T7-TPase+(Plasmid+%2351818)/bio_rxiv__64898__2026__02__06__702658-151-0-3
Average 93 stars, based on 6 article reviews
Tol2 Transposase Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tol2+transposase+rna/T7-TPase+(Plasmid+%2351818)/bio_rxiv__64898__2026__02__06__702658-151-0-3
Average 93 stars, based on 6 article reviews
tol2 transposase rna - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and Amplification:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and Clone Assay:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and Plasmid Preparation:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and Article Title: Clostridium perfringens Epsilon Toxin Compromises the Blood-Brain Barrier in a Humanized Zebrafish Model Article Snippet: A second control vector, GFP under the same enhancer/promoter (pTol2-fliep:EGFPDest), was delivered in a bacterial stab, a gift from Nathan Lawson (Addgene Plasmid #73491), streaked on a ampicillin selective agar, and isolated using mini prep. .. Tol2 transposase mRNA was generated from the pT3TS-Tol2 plasmid that contained Construct:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and Injection:Article Title: RecV recombinase system for in vivo targeted optogenomic modifications of single cells or cell populations Article Snippet: .. N-CreV and C-CreV were PCR amplified from pAAV-Ef1a NCreV and pAAV-Ef1a CCreV, and cloned into the pDest-ubi vector (Addgene plasmid # 27323) by Gibson assembly with the following primers: 5’ N-Cre overlap pdest-UBI: attcgacccaagtttgtacaaaaaagcaggctggacgccaccatgacgagtgatgaggtt; 5’ C-Cre overlap pdest-UBI: tcgacccaagtttgtacaaaaaagcaggctggacgccaccatgcatacactgtatgcccc; 3’ polyA (used for both constructs): actgctcccttccctgtccttctgcatcgatgatgatccagacatgataagatacattga The pDest-ubi:N-vCre-pDest and pDest-ubi:C-vCre mixture containing equal amounts of each plasmid (25pg each) and In Vitro:Article Title: Macrophage adaptation to hypoxia in the tuberculous granuloma potentiates mycobacterium-induced mitochondrial damage and granuloma necrosis Article Snippet: .. Generated:Article Title: Clostridium perfringens Epsilon Toxin Compromises the Blood-Brain Barrier in a Humanized Zebrafish Model Article Snippet: A second control vector, GFP under the same enhancer/promoter (pTol2-fliep:EGFPDest), was delivered in a bacterial stab, a gift from Nathan Lawson (Addgene Plasmid #73491), streaked on a ampicillin selective agar, and isolated using mini prep. .. Tol2 transposase mRNA was generated from the pT3TS-Tol2 plasmid that contained Isolation:Article Title: Clostridium perfringens Epsilon Toxin Compromises the Blood-Brain Barrier in a Humanized Zebrafish Model Article Snippet: A second control vector, GFP under the same enhancer/promoter (pTol2-fliep:EGFPDest), was delivered in a bacterial stab, a gift from Nathan Lawson (Addgene Plasmid #73491), streaked on a ampicillin selective agar, and isolated using mini prep. .. Tol2 transposase mRNA was generated from the pT3TS-Tol2 plasmid that contained |